circad | circRNAs associated with diseases

hsa_circ_102347
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Hepatic carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	29609527
Experimental Method
Sample Type	Blood samples	Comparison	4 perioperative liver transplantation tissue and 4 normal control
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTTAGCAGATTTTCTTCGTTGTC Reverse TTCCTGTTTGGTTTGGTTCC	Statistics	Fold Change : Downregulated pvalue : p<0.01
Citation
Sui, W, Gan, Q, Liu, F, Chen, H, Liu, J, Dai, Y (2018). The differentially expressed circular ribonucleic acids of primary hepatic carcinoma following liver transplantation as new diagnostic biomarkers for primary hepatic carcinoma. Tumour Biol., 40, 4:1010428318766928.